pires egfp puro vector Search Results


99
ATCC hek293t cells
Hek293t Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc03784025-161-0-2?v=ATCC
Average 99 stars, based on 1 article reviews
hek293t cells - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

99
New England Biolabs gtcatccttgtagtcctcgagttt gca ggg ttt tat ggc taca vector pires hrgfp 1a
Gtcatccttgtagtcctcgagttt Gca Ggg Ttt Tat Ggc Taca Vector Pires Hrgfp 1a, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pm36750933-62-9-24?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
gtcatccttgtagtcctcgagttt gca ggg ttt tat ggc taca vector pires hrgfp 1a - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

90
Becton Dickinson pires-egfp bicistronic vector
Pires Egfp Bicistronic Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc00284789-114-18-21?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
pires-egfp bicistronic vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Becton Dickinson pires-egfp vector
Pires Egfp Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc04487042-52-8-10?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
pires-egfp vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Becton Dickinson pires neo2 expression vector
Pires Neo2 Expression Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/us10591490-233-1-5?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
pires neo2 expression vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lncrna-nef expression pires vectors
Lncrna Nef Expression Pires Vectors, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc06507433-34-29-35?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lncrna-nef expression pires vectors - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Becton Dickinson internal ribosome entry site (pires) vector
Internal Ribosome Entry Site (Pires) Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pm19153151-45-15-21?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
internal ribosome entry site (pires) vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
Addgene inc pires puro vector
Pires Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc07958614-36-21-23?v=Addgene+inc
Average 96 stars, based on 1 article reviews
pires puro vector - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
Becton Dickinson pires vector
Pires Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/us10195292-89-19-22?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
pires vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Becton Dickinson pires expression plasmid
Pires Expression Plasmid, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/10__1158_slash_0008___5472__can___05___2891-56-1-7?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
pires expression plasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Addgene inc pires egfp puro vector
Pires Egfp Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc08391641-43-16-18?v=Addgene+inc
Average 93 stars, based on 1 article reviews
pires egfp puro vector - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Shanghai GenePharma pires vectors containing (sh)rnas targeting pitpna-as1
Pires Vectors Containing (Sh)rnas Targeting Pitpna As1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pires+egfp+puro+vector/pmc07830934-33-25-48?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
pires vectors containing (sh)rnas targeting pitpna-as1 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results