99
|
ATCC
hek293t cells Hek293t Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc03784025-161-0-2?v=ATCC Average 99 stars, based on 1 article reviews
hek293t cells - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
99
|
New England Biolabs
gtcatccttgtagtcctcgagttt gca ggg ttt tat ggc taca vector pires hrgfp 1a Gtcatccttgtagtcctcgagttt Gca Ggg Ttt Tat Ggc Taca Vector Pires Hrgfp 1a, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pm36750933-62-9-24?v=New+England+Biolabs Average 99 stars, based on 1 article reviews
gtcatccttgtagtcctcgagttt gca ggg ttt tat ggc taca vector pires hrgfp 1a - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
pires-egfp bicistronic vector Pires Egfp Bicistronic Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc00284789-114-18-21?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
pires-egfp bicistronic vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
pires-egfp vector Pires Egfp Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc04487042-52-8-10?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
pires-egfp vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
pires neo2 expression vector Pires Neo2 Expression Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/us10591490-233-1-5?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
pires neo2 expression vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
lncrna-nef expression pires vectors Lncrna Nef Expression Pires Vectors, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc06507433-34-29-35?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
lncrna-nef expression pires vectors - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
internal ribosome entry site (pires) vector Internal Ribosome Entry Site (Pires) Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pm19153151-45-15-21?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
internal ribosome entry site (pires) vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
96
|
Addgene inc
pires puro vector Pires Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc07958614-36-21-23?v=Addgene+inc Average 96 stars, based on 1 article reviews
pires puro vector - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
pires vector Pires Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/us10195292-89-19-22?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
pires vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
pires expression plasmid Pires Expression Plasmid, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/10__1158_slash_0008___5472__can___05___2891-56-1-7?v=Becton+Dickinson Average 90 stars, based on 1 article reviews
pires expression plasmid - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pires egfp puro vector Pires Egfp Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc08391641-43-16-18?v=Addgene+inc Average 93 stars, based on 1 article reviews
pires egfp puro vector - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
pires vectors containing (sh)rnas targeting pitpna-as1 Pires Vectors Containing (Sh)rnas Targeting Pitpna As1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pires+egfp+puro+vector/pmc07830934-33-25-48?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
pires vectors containing (sh)rnas targeting pitpna-as1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |